Stem-loop sequence ipu-mir-143

AccessionMI0024509 (change log)
DescriptionIctalurus punctatus miR-143 stem-loop
Gene family MIPF0000094; mir-143
Stem-loop
   -- g         g      u  -  aa 
5'   g ugcagugcu caucuc gg uc  c
     | ||||||||| |||||| || ||   
3'   c augucacga guagag cu ag  u
   cu g         a      u  g  gg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-143

Accession MIMAT0029420
Sequence

35 - 

ugagaugaagcacuguagcuc

 - 55

Get sequence
Evidence experimental; Illumina [1]

References

1