Stem-loop sequence ipu-mir-200a

AccessionMI0024554 (change log)
DescriptionIctalurus punctatus miR-200a stem-loop
Gene family MIPF0000019; mir-8
Stem-loop
       -             c    cuguau 
5' cauc uuaccggacagug ugga      a
   |||| ||||||||||||| ||||       
3' guag aauggucugucac aucu      a
       c             a    uuuguc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-200a

Accession MIMAT0029453
Sequence

39 - 

uaacacugucugguaacgaug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1