Stem-loop sequence ipu-mir-25

AccessionMI0024599 (change log)
DescriptionIctalurus punctatus miR-25 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --    g     uu g    c    g  au 
5'   aggc gagac  g gcag ugcc uc  u
     |||| |||||  | |||| |||| ||  c
3'   ucug cucug  c cguu acgg ag  c
   ag    g     uu a    -    a  ac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-25

Accession MIMAT0029484
Sequence

39 - 

cauugcacuugucucggucuga

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1