Stem-loop sequence ipu-mir-92a-2

AccessionMI0024664 (change log)
DescriptionIctalurus punctatus miR-92a-2 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   --          c  cc        -  g 
5'   agguugggau gg  gcaaugcu cu u
     |||||||||| ||  |||||||| || g
3'   uccggcccug uc  cguuauga gg c
   ug          u  -a        a  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-92a

Accession MIMAT0029529
Sequence

36 - 

uauugcacuugucccggccugu

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1