Stem-loop sequence ipu-mir-7572

AccessionMI0024707 (change log)
DescriptionIctalurus punctatus miR-7572 stem-loop
Literature search

1 open access papers mention ipu-mir-7572
(2 sentences)

Stem-loop
   --       -       c       a  uuu 
5'   aaacacu ugaagcu caauuug gu   u
     ||||||| ||||||| ||||||| ||   c
3'   uuuguga auuucga guuagac cg   u
   cc       c       c       -  ugc 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence ipu-miR-7572

Accession MIMAT0029571
Sequence

39 - 

gauugcagcuuuacaguguuucc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1