Stem-loop sequence cbr-mir-7583c

AccessionMI0024729 (change log)
DescriptionCaenorhabditis briggsae miR-7583c stem-loop
Gene family MIPF0001676; mir-7583
Stem-loop
   --   ug    a    u       uc  a 
5'   agc  caaa gucg gguggca  ac a
     |||  |||| |||| |||||||  || g
3'   uug  guuu cagc cuaccgu  ug u
   ag   gu    a    -       uc  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrX: 10872909-10872966 [+]
intergenic
Database links

Mature sequence cbr-miR-7583c-5p

Accession MIMAT0029593
Sequence

1 - 

agcugcaaaagucgugguggc

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence cbr-miR-7583c-3p

Accession MIMAT0029594
Sequence

38 - 

ccauccgacauuugugguuga

 - 58

Get sequence
Evidence experimental; Illumina [1]

References

1