Stem-loop sequence cbr-mir-64c

AccessionMI0024740 (change log)
DescriptionCaenorhabditis briggsae miR-64c stem-loop
Stem-loop
   --ca  a   a u   u  u     au  uu 
5'     ug cac c ggc gg cugga  ga  u
       || ||| | ||| || |||||  ||  c
3'     ac gug g ccg cc ggccu  cu  g
   aagc  c   a c   -  u     -c  cg 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (CB4; GCA_000004555.3) Overlapping transcripts
chrIII: 869360-869420 [-]
intergenic
Clustered miRNAs
< 10kb from cbr-mir-64c
cbr-mir-2226chrIII: 869446-869544 [-]
cbr-mir-64cchrIII: 869360-869420 [-]
cbr-mir-64achrIII: 869205-869314 [-]
cbr-mir-64bchrIII: 869080-869196 [-]
cbr-mir-65chrIII: 868808-868904 [-]
Database links

Mature sequence cbr-miR-64c

Accession MIMAT0029603
Sequence

1 - 

caugacacacuggcuggucugga

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1