Stem-loop sequence crm-mir-7604

AccessionMI0024760 (change log)
DescriptionCaenorhabditis remanei miR-7604 stem-loop
Stem-loop
   --c            u  -      -gga    aa 
5'    gauguucaguua gg auacgu    aaug  g
      |||||||||||| || ||||||    ||||  a
3'    cuaugagucaau cc uaugca    uuau  a
   cua            -  g      aagg    ag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig84: 278840-278907 [+]
intergenic
Database links

Mature sequence crm-miR-7604

Accession MIMAT0029621
Sequence

1 - 

cgauguucaguuauggauacgu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1