Stem-loop sequence crm-mir-392

AccessionMI0024771 (change log)
DescriptionCaenorhabditis remanei miR-392 stem-loop
Stem-loop
   --    u        a  a      a  au 
5'   cggu uacauggu ga gauauc gu  a
     |||| |||||||| || |||||| ||  a
3'   gucg auguacua cu cuauag ua  a
   cu    u        g  a      a  aa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig31: 151833-151893 [+]
intergenic
Database links

Mature sequence crm-miR-392

Accession MIMAT0029632
Sequence

40 - 

aucaucgaucauguaugcuguc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1