Stem-loop sequence crm-mir-7613

AccessionMI0024778 (change log)
DescriptionCaenorhabditis remanei miR-7613 stem-loop
Stem-loop
   --c   a     -  u      ac     a    
5'    aug caccu ac cgcucg  gucgu ucg 
      ||| ||||| || ||||||  ||||| || c
3'    uac gugga ug gugggc  cagca agu 
   cca   g     g  -      --     a    
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (WS200) Overlapping transcripts
Crem_Contig41: 71834-71894 [+]
intergenic
Clustered miRNAs
< 10kb from crm-mir-7613
crm-mir-7613Crem_Contig41: 71834-71894 [+]
crm-mir-64aCrem_Contig41: 71965-72073 [+]
crm-mir-66Crem_Contig41: 72081-72200 [+]
crm-mir-64bCrem_Contig41: 72225-72316 [+]
crm-mir-64cCrem_Contig41: 72317-72434 [+]
crm-mir-64dCrem_Contig41: 72472-72586 [+]
crm-mir-64eCrem_Contig41: 72615-72729 [+]
Database links

Mature sequence crm-miR-7613

Accession MIMAT0029639
Sequence

1 - 

caugacaccuacucgcucgacgucg

 - 25

Get sequence
Evidence experimental; Illumina [1]

References

1