Stem-loop sequence cbn-mir-7628

AccessionMI0024814 (change log)
DescriptionCaenorhabditis brenneri miR-7628 stem-loop
Stem-loop
   --u     c    ugaa       -  ua 
5'    gaguu ggac    guauauc ca  g
      ||||| ||||    ||||||| ||  u
3'    cucga ccug    cauguag gu  u
   uag     u    -uaa       a  uu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig68: 286417-286473 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-7628
cbn-mir-7628Cbre_Contig68: 286417-286473 [+]
cbn-mir-7619Cbre_Contig68: 286553-286612 [+]
cbn-mir-7632Cbre_Contig68: 286710-286767 [+]
Database links

Mature sequence cbn-miR-7628

Accession MIMAT0029670
Sequence

37 - 

uguacaauguccuagcucgau

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1