Stem-loop sequence cbn-mir-63

AccessionMI0024846 (change log)
DescriptionCaenorhabditis brenneri miR-63 stem-loop
Gene family MIPF0000823; mir-63
Stem-loop
   --          --    a     -ug    gacc 
5'   uucaacucgu  cggu gucau   uucg    a
     ||||||||||  |||| |||||   ||||     
3'   agguugagcg  guca cagua   aagu    g
   aa          aa    -     uca    aaag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig9: 1512106-1512171 [+]
intergenic
Database links

Mature sequence cbn-miR-63

Accession MIMAT0029696
Sequence

43 - 

uaugacacugaagcgaguuggaaa

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1