Stem-loop sequence cbn-mir-64m

AccessionMI0024847 (change log)
DescriptionCaenorhabditis brenneri miR-64m stem-loop
Stem-loop
   ca        a   c        - uu 
5'   ugacacgu guu gcugaaau c  a
     |||||||| ||| |||||||| |  c
3'   acugugca caa ugacuuua g  c
   ga        -   u        c ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig102: 61078-61132 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-64m
cbn-mir-7629Cbre_Contig102: 60960-61019 [+]
cbn-mir-64mCbre_Contig102: 61078-61132 [+]
Database links

Mature sequence cbn-miR-64m

Accession MIMAT0029697
Sequence

1 - 

caugacacguaguucgcugaaau

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1