Stem-loop sequence cbn-mir-64f

AccessionMI0024849 (change log)
DescriptionCaenorhabditis brenneri miR-64f stem-loop
Gene family MIPF0000295; mir-64
Stem-loop
   --   ga      ag    u     -  a  uua 
5'   uau  cacuua  cuaa cugaa cc au   g
     |||  ||||||  |||| ||||| || ||    
3'   aua  gugaau  gauu gacuu gg ua   a
   ug   ag      -a    u     a  a  uca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig274: 39560-39625 [-]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-64f
cbn-mir-64j-1Cbre_Contig274: 39823-39884 [-]
cbn-mir-64fCbre_Contig274: 39560-39625 [-]
cbn-mir-64b-1Cbre_Contig274: 39431-39495 [-]
cbn-mir-64h-1Cbre_Contig274: 39311-39375 [-]
cbn-mir-64a-5Cbre_Contig274: 39182-39246 [-]
cbn-mir-64d-1Cbre_Contig274: 39055-39119 [-]
cbn-mir-64eCbre_Contig274: 38928-38992 [-]
cbn-mir-64b-2Cbre_Contig274: 38801-38865 [-]
cbn-mir-64c-2Cbre_Contig274: 38550-38614 [-]
cbn-mir-64a-2Cbre_Contig274: 38399-38463 [-]
cbn-mir-64i-2Cbre_Contig274: 38272-38338 [-]
cbn-mir-64g-2Cbre_Contig274: 38025-38086 [-]
cbn-mir-64k-1Cbre_Contig274: 37911-37974 [-]
cbn-mir-64lCbre_Contig274: 37788-37847 [-]
Database links

Mature sequence cbn-miR-64f

Accession MIMAT0029699
Sequence

1 - 

uaugacacuuaagcuaaucugaa

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1