Stem-loop sequence cbn-mir-64i-1

AccessionMI0024858 (change log)
DescriptionCaenorhabditis brenneri miR-64i-1 stem-loop
Gene family MIPF0000295; mir-64
Stem-loop
   --    a      u     c    ----cg     u 
5'   uaug cacgga caaug uuga      uugau u
     |||| |||||| ||||| ||||      |||||  
3'   guac gugcuu guuac aacu      aacua a
   cc    g      -     u    aaaaua     a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig230: 84693-84759 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-64i-1
cbn-mir-64j-2Cbre_Contig230: 83144-83205 [+]
cbn-mir-64h-2Cbre_Contig230: 83652-83716 [+]
cbn-mir-64a-1Cbre_Contig230: 83781-83845 [+]
cbn-mir-64d-2Cbre_Contig230: 83908-83972 [+]
cbn-mir-64a-4Cbre_Contig230: 84290-84354 [+]
cbn-mir-64c-1Cbre_Contig230: 84417-84481 [+]
cbn-mir-64a-3Cbre_Contig230: 84568-84632 [+]
cbn-mir-64i-1Cbre_Contig230: 84693-84759 [+]
cbn-mir-64g-1Cbre_Contig230: 84925-84986 [+]
cbn-mir-64k-2Cbre_Contig230: 85037-85092 [+]
Database links

Mature sequence cbn-miR-64i

Accession MIMAT0029706
Sequence

1 - 

uaugacacggaucaaugcuugac

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1