Stem-loop sequence cbn-mir-46

AccessionMI0024921 (change log)
DescriptionCaenorhabditis brenneri miR-46 stem-loop
Gene family MIPF0000087; mir-46
Stem-loop
   --        -cg     u      ucgu u   uu 
5'   aagagagc   ucuau gacagu    c cug  c
     ||||||||   ||||| ||||||    | |||   
3'   uucucucg   aggua cuguca    g gac  a
   ac        cug     -      ---u -   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig13: 883775-883840 [-]
intergenic
Database links

Mature sequence cbn-miR-46

Accession MIMAT0029743
Sequence

45 - 

ugucauggagucgcucucuuca

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1