Stem-loop sequence cbn-mir-235

AccessionMI0024941 (change log)
DescriptionCaenorhabditis brenneri miR-235 stem-loop
Stem-loop
   --     cu   u  c    u     -  ucaacg 
5'   agguc  ggc ga ugca auauu gc      u
     |||||  ||| || |||| ||||| ||      u
3'   uccgg  ccg cu acgu uauaa cg      a
   ag     cc   -  c    -     u  uaagaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig98: 204892-204959 [+]
intergenic
Database links

Mature sequence cbn-miR-235

Accession MIMAT0029757
Sequence

47 - 

uauugcacucgccccggccuga

 - 68

Get sequence
Evidence experimental; Illumina [1]

References

1