Stem-loop sequence cbn-mir-7620b

AccessionMI0024942 (change log)
DescriptionCaenorhabditis brenneri miR-7620b stem-loop
Stem-loop
   --        a    g         -   aag 
5'   uauugcac aauu uguucaucu auu   g
     |||||||| |||| ||||||||| |||    
3'   auaacgug uuag guaaguaga uaa   u
   ua        c    -         a   agu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig81: 7825-7886 [+]
intergenic
Clustered miRNAs
< 10kb from cbn-mir-7620b
cbn-mir-7631Cbre_Contig81: 3849-3912 [+]
cbn-mir-7620bCbre_Contig81: 7825-7886 [+]
Database links

Mature sequence cbn-miR-7620b

Accession MIMAT0029758
Sequence

1 - 

uauugcacaaauuguguucaucu

 - 23

Get sequence
Evidence experimental; Illumina [1]

References

1