Stem-loop sequence cbn-mir-7690

AccessionMI0025083 (change log)
DescriptionCaenorhabditis brenneri miR-7690 stem-loop
Stem-loop
   --   uu         u     g    aacacu 
5'   uuu  caacuuccg gguga uuug      u
     |||  ||||||||| ||||| ||||       
3'   aaa  guugagggc cuacu aaac      g
   ag   gg         -     -    cuacaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (C_brenneri-6.0.1b; GCA_000143925.2) Overlapping transcripts
Cbre_Contig17: 141094-141157 [+]
intergenic
Database links

Mature sequence cbn-miR-7690

Accession MIMAT0029942
Sequence

42 - 

aaucauccgggaguugggaaaga

 - 64

Get sequence
Evidence experimental; Illumina [1]

References

1