Stem-loop sequence mtr-MIR2653d

AccessionMI0025206 (change log)
DescriptionMedicago truncatula miR2653d stem-loop
Gene family MIPF0000878; MIR2653
Stem-loop
   -----------------------------------------------------------------------------------------------------------------------------cgacaacccucuuccaaaucacgcugcugugaacaugauuga     au     -----   -ucc     u 
5'                                                                                                                                                                        gguau  gagga     agc    cggac u
                                                                                                                                                                          |||||  |||||     |||    ||||| g
3'                                                                                                                                                                        ccgug  cuccu     uug    gccug a
   ucugaccguguuagugugucugcagcgacugucaguuuauuaacaacaaguaguucgagaccuacaguaaaauuuguugcgucguuggguuuccuaaugucuuaguaagaaccguuaaccguacuaguaccaguuugucucuccgaaccguauugaacuacacauca     gu     caaca   uaau     c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr6: 15865275-15865540 [-]
intergenic
Database links

Mature sequence mtr-miR2653d

Accession MIMAT0029966
Sequence

19 - 

ucacgcugcugugaacaugau

 - 39

Get sequence
Evidence experimental; 454 [1]

References

1
PMID:19767456 "Genome-wide Medicago truncatula small RNA analysis revealed novel microRNAs and isoforms differentially regulated in roots and nodules" Lelandais-Briere C, Naya L, Sallet E, Calenge F, Frugier F, Hartmann C, Gouzy J, Crespi M Plant Cell. 21:2780-2796(2009).