Stem-loop sequence mtr-MIR7697

AccessionMI0025226 (change log)
DescriptionMedicago truncatula miR7697 stem-loop
Stem-loop
                     ga                        c             uuuuuuu                      a     a     -    a    uc            ag  ga    cac  -   ag 
5' gguccgaucuauauccga  uauuugaucggaggcuugaaauuu uuauccuuuuuuu       uaugauugugacaguucauggg agaug uccau acgg uggg  ucaucuggugac  ug  gcuu   ug aac  a
   ||||||||||||||||||  |||||||||||||||||||||||| |||||||||||||       |||||||||||||||||||||| ||||| ||||| |||| ||||  ||||||||||||  ||  ||||   || |||   
3' cuaggcuagauauaggcu  auaaacuagccuccgaacuuuaaa aauaggaaaaaaa       auacuaacacugucaaguaccc ucuac aggua uguc gcuu  aguagacuauug  ac  cgaa   ac uug  u
                     ag                        u             -------                      c     -     a    -    -u            -g  -a    ---  g   ga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (JCVI_Mt3.5.2) Overlapping transcripts
chr3: 16805134-16805406 [+]
intergenic
Database links

Mature sequence mtr-miR7697-5p

Accession MIMAT0029994
Sequence

14 - 

uccgagauauuugaucggagg

 - 34

Get sequence
Evidence experimental; Illumina [1]

Mature sequence mtr-miR7697-3p

Accession MIMAT0029995
Sequence

242 - 

uccgaucaaauagaucggaua

 - 262

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23572382 "microRNA profiling of root tissues and root forming explant cultures in Medicago truncatula" Eyles RP, Williams PH, Ohms SJ, Weiller GF, Ogilvie HA, Djordjevic MA, Imin N Planta. 238:91-105(2013).