Stem-loop sequence oar-mir-25

AccessionMI0025272 (change log)
DescriptionOvis aries miR-25 stem-loop
Gene family MIPF0000013; mir-25
Literature search

2 open access papers mention oar-mir-25
(2 sentences)

Stem-loop
       a ug   ag    g     uu g     u   -  acg 
5' ggcc g  uug  aggc gagac  g gcaau gcu gg   c
   |||| |  |||  |||| |||||  | ||||| ||| ||    
3' ccgg c  gac  ucug cucug  c cguua cgg cc   u
       c gu   ag    g     uu a     -   g  ccg 
Get sequence
Deep sequencing
9541 reads, 2.2e+03 reads per million, 13 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Oar_v4.0; GCA_000298735.2) Overlapping transcripts
chr24: 36244530-36244613 [+]
sense
ENSOART00000019374 ; MCM7-201; intron 14
Clustered miRNAs
< 10kb from oar-mir-25
oar-mir-106bchr24: 36244122-36244201 [+]
oar-mir-25chr24: 36244530-36244613 [+]
Database links

Mature sequence oar-miR-25

Accession MIMAT0030050
Sequence

53 - 

auugcacuugucucggucuga

 - 73

Get sequence
Deep sequencing9363 reads, 13 experiments
Evidence experimental; cloned [1]

References

1
PMID:23269700 "MicroRNA in the ovine mammary gland during early pregnancy: spatial and temporal expression of miR-21, miR-205, and miR-200" Galio L, Droineau S, Yeboah P, Boudiaf H, Bouet S, Truchet S, Devinoy E Physiol Genomics. 45:151-161(2013).