Stem-loop sequence bdi-MIR7726a

AccessionMI0025341 (change log)
DescriptionBrachypodium distachyon miR7726a stem-loop
Gene family MIPF0001804; MIR7726
Stem-loop
   --      ua aaau   u  ug     -     cg       acg   uu 
5'   auuaaa  g    ugg ga  auggu acgga  ucgcggu   uca  u
     ||||||  |    ||| ||  ||||| |||||  |||||||   |||   
3'   uaauuu  c    acc cu  ugcca ugucu  agcguua   agu  c
   uc      uc gcac   c  gu     c     -a       --a   ca 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
3: 15036602-15036699 [-]
intergenic
Database links

Mature sequence bdi-miR7726a-5p

Accession MIMAT0030184
Sequence

17 - 

ugaugaugguacggacgucgcggu

 - 40

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7726a-3p

Accession MIMAT0030185
Sequence

59 - 

ugcgaaucugucaccguugucccc

 - 82

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).