Stem-loop sequence bdi-MIR7728

AccessionMI0025343 (change log)
DescriptionBrachypodium distachyon miR7728 stem-loop
Stem-loop
   --ccccua    ---    c                    g     c     cu 
5'         ggcc   ugcu ggauugaguguauuuuuagu ggggg uggua  u
           ||||   |||| |||||||||||||||||||| ||||| |||||   
3'         ccgg   acga cuuaacucacauaaaaauca ccccc accau  a
   guuaauuc    ucg    a                    a     a     ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
2: 9800174-9800278 [+]
intergenic
Database links

Mature sequence bdi-miR7728-5p

Accession MIMAT0030188
Sequence

11 - 

ugcucggauugaguguauuuu

 - 31

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7728-3p

Accession MIMAT0030189
Sequence

71 - 

aaauacacucaauucaagcag

 - 91

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).