Stem-loop sequence bdi-MIR7762

AccessionMI0025382 (change log)
DescriptionBrachypodium distachyon miR7762 stem-loop
Stem-loop
                                 u    a        aug           a                     c   ca                   a      gagccu   a a c  u           c   gca 
5' agggagcaaugccaguugaugaccaaguuc cgag agcuagaa   ucguaugauag gaccauccaacgguagagaga aau  aucuuuccaacaaugaaag uuguag      agg g g ug gaaguaguggg aau   u
   |||||||||||||||||||||||||||||| |||| ||||||||   ||||||||||| ||||||||||||||||||||| |||  ||||||||||||||||||| ||||||      ||| | | || ||||||||||| |||   g
3' uccuucguuacggucaacuacugguuuaag gcuc ucggucuu   aguauacuauc cugguagguugucaucucucu uua  uagaaagguuguuacuuuc aacauc      ucc c c ac uuucauuaccc uua   a
                                 -    c        -aa           c                     u   ug                   c      ------   - - a  u           u   aga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
5: 21791921-21792207 [-]
intergenic
Database links

Mature sequence bdi-miR7762-5p

Accession MIMAT0030270
Sequence

13 - 

caguugaugaccaaguucucgaga

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7762-3p

Accession MIMAT0030271
Sequence

254 - 

cucggaauuuggucaucaacuggc

 - 277

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).