Stem-loop sequence bdi-MIR7769

AccessionMI0025391 (change log)
DescriptionBrachypodium distachyon miR7769 stem-loop
Stem-loop
   a u   -  a                      c   c   g       u  au    --  a uc         c         ag        cggcggcucacgcggggcagagcgcguggcggcuggccacgcggggugagagcgucagcggcgugcacgugccaaggcgacgacagcgccugu 
5'  c gug gg cccacccgucagugccaacaug cag cug gcuugcc gc  guag  cg g  gaugccgau gccuugccu  agcuucgg                                                                                             g
    | ||| || |||||||||||||||||||||| ||| ||| ||||||| ||  ||||  || |  ||||||||| |||||||||  ||||||||                                                                                             c
3'  g cac cc ggguggguagucacgguuguac guc gac cgaacgg cg  cauc  gc c  cuacgguua cggaacggg  ucgaagcc                                                                                             g
   g c   g  -                      u   a   a       u  --    ua  c ca         c         --        auacggcuaccgaacgggucgggcgggcgcacggguggcacgaaacuucggaagcagcgguaccgggagcccuggucggcggcaagggcggga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 2375800-2376168 [+]
intergenic
Database links

Mature sequence bdi-miR7769-5p

Accession MIMAT0030288
Sequence

15 - 

ccgucagugccaacaugccag

 - 35

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7769-3p

Accession MIMAT0030289
Sequence

336 - 

ugucauguuggcacugauggg

 - 356

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).