Stem-loop sequence bdi-MIR7784a

AccessionMI0025406 (change log)
DescriptionBrachypodium distachyon miR7784a stem-loop
Gene family MIPF0001728; MIR7784
Stem-loop
   caaa    --c  -     a  aa        a -ga     a  uau     aucacauguauc 
5'     uacc   cg uguac ug  cuuauaag c   guaca cg   gguac            u
       ||||   || ||||| ||  |||||||| |   ||||| ||   |||||             
3'     augg   gc acaug gc  gaguauuc g   caugu gc   ccaug            u
   -uac    uau  u     a  -a        a aua     -  --u     aauuuuugauua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
4: 4781925-4782047 [+]
intergenic
Database links

Mature sequence bdi-miR7784a-5p

Accession MIMAT0030322
Sequence

13 - 

guacaugaacuuauaagacgagua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7784a-3p

Accession MIMAT0030323
Sequence

88 - 

cauagacuuaugagacgaguacau

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).