Stem-loop sequence bdi-MIR7784b

AccessionMI0025407 (change log)
DescriptionBrachypodium distachyon miR7784b stem-loop
Gene family MIPF0001728; MIR7784
Stem-loop
   uaaa    --c  -     a  aa        a -ga     acg        aucac  g  uc 
5'     uacc   cg uguac ug  cuuauaag c   guaca   uaugguac     aa ua  u
       ||||   || ||||| ||  |||||||| |   |||||   ||||||||     || ||   
3'     augg   gc acaug gc  gaguauuc g   caugu   guaccaug     uu au  u
   -uac    uau  u     a  -a        a aua     ---        aauuu  g  ua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Bd21; GCA_000005505.1) Overlapping transcripts
1: 8415427-8415549 [+]
intergenic
Database links

Mature sequence bdi-miR7784b-5p

Accession MIMAT0030324
Sequence

13 - 

guacaugaacuuauaagacgagua

 - 36

Get sequence
Evidence experimental; Illumina [1]

Mature sequence bdi-miR7784b-3p

Accession MIMAT0030325
Sequence

88 - 

cauagacuuaugagacgaguacau

 - 111

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23264558 "Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon" Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E Mol Plant. 6:423-443(2013).