Stem-loop sequence ptc-MIR7828

AccessionMI0025488 (change log)
DescriptionPopulus trichocarpa miR7828 stem-loop
Stem-loop
   uuuuuuua                       u          -uaau    aauguugugagugagcauaaaauuugggaugugaauaugug 
5'         aaaugaugacauggacaccaaaa cuuacaagaa     gguu                                         u
           ||||||||||||||||||||||| ||||||||||     ||||                                          
3'         uuuacuacuguaccugugguuuu gaauguuuuu     ccag                                         u
   auagguaa                       u          uuaau    aaauagugagauccauacgguacugugguuaauuggguucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Poptr2_0; GCA_000002775.2) Overlapping transcripts
CM000337.2: 35822741-35822925 [-]
intergenic
Database links

Mature sequence ptc-miR7828

Accession MIMAT0030388
Sequence

13 - 

gaugacauggacaccaaaauc

 - 33

Get sequence
Evidence experimental; Illumina [1]

References

1