Stem-loop sequence bta-mir-7858

AccessionMI0025528 (change log)
DescriptionBos taurus miR-7858 stem-loop
Stem-loop
   --        g   ag     u    auu 
5'   uaggauuu gaa  auugc uuga   u
     |||||||| |||  ||||| ||||   g
3'   auucuaaa cuu  uaacg aacu   u
   cg        a   cu     c    aga 
Get sequence
Deep sequencing
7406 reads, 26 reads per million, 73 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr20: 10233343-10233401 [-]
sense
ENSBTAT00000000734 ; OCLN-201; intron 3
Clustered miRNAs
< 10kb from bta-mir-7858
bta-mir-11986bchr20: 10234322-10234378 [-]
bta-mir-7858chr20: 10233343-10233401 [-]
Database links

Mature sequence bta-miR-7858

Accession MIMAT0030433
Sequence

37 - 

acgcaauucuucaaaaucuuagc

 - 59

Get sequence
Deep sequencing44 reads, 25 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).