Stem-loop sequence bta-mir-6516

AccessionMI0025538 (change log)
DescriptionBos taurus miR-6516 stem-loop
Gene family MIPF0001672; mir-6516
Literature search

1 open access papers mention bta-mir-6516
(1 sentences)

Stem-loop
   -         a  g ug   a    cu   a 
5'  uuugcagua ca g  uga cauu  agc g
    ||||||||| || |  ||| ||||  |||  
3'  aaacgucau gu u  acu guag  uug c
   c         a  a gu   a    -u   a 
Get sequence
Deep sequencing
47 reads, 20 reads per million, 25 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Btau_5.0.1; GCA_000003205.6) Overlapping transcripts
chr19: 55638811-55638872 [+]
sense
ENSBTAT00000061876 ; SCARNA16-201; exon 1
Database links

Mature sequence bta-miR-6516

Accession MIMAT0030443
Sequence

1 - 

uuugcaguaacaggugugaac

 - 21

Get sequence
Deep sequencing35 reads, 22 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:23472090 "Next generation sequencing reveals the expression of a unique miRNA profile in response to a gram-positive bacterial infection" Lawless N, Foroushani AB, McCabe MS, O'Farrelly C, Lynn DJ PLoS One. 8:e57543(2013).