Stem-loop sequence prd-mir-239

AccessionMI0025552 (change log)
DescriptionPanagrellus redivivus miR-239 stem-loop
Stem-loop
   --a       - u     gu       -   a 
5'    uuguacu c ccaag  uuucuga uuu u
      ||||||| | |||||  ||||||| |||  
3'    aacauga g gguuc  gaagacu aag u
   gga       c u     --       c   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455521.1: 89576-89635 [-]
intergenic
Database links

Mature sequence prd-miR-239-5p

Accession MIMAT0030462
Sequence

1 - 

auuguacucuccaagguuuucug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-239-3p

Accession MIMAT0030463
Sequence

38 - 

agaagcuuggugcaguacaaagg

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).