Stem-loop sequence prd-mir-7870

AccessionMI0025563 (change log)
DescriptionPanagrellus redivivus miR-7870 stem-loop
Stem-loop
   - gg    uu     a         cgaag 
5'  c  uacu  gugga ugcaugagu     c
    |  ||||  ||||| |||||||||     a
3'  g  guga  uaccu acguacuca     u
   c uu    cu     a         uauga 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455543.1: 82750-82811 [-]
intergenic
Clustered miRNAs
< 10kb from prd-mir-7870
prd-mir-7870KB455543.1: 82750-82811 [-]
prd-mir-7882KB455543.1: 82436-82494 [-]
Database links

Mature sequence prd-miR-7870-5p

Accession MIMAT0030484
Sequence

1 - 

cgguacuuuguggaaugcaugag

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-7870-3p

Accession MIMAT0030485
Sequence

41 - 

caugcaauccauucaguguugc

 - 62

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).