Stem-loop sequence prd-mir-7880a

AccessionMI0025580 (change log)
Previous IDsprd-mir-7880
DescriptionPanagrellus redivivus miR-7880a stem-loop
Stem-loop
   u a      -     g     c   aaucc 
5'  g ccugga auggu uguaa agc     c
    | |||||| ||||| ||||| |||     u
3'  c ggaccu ugcca gcguu ucg     u
   a c      a     -     -   auuua 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB454964.1: 33315-33374 [+]
intergenic
Database links

Mature sequence prd-miR-7880a-5p

Accession MIMAT0030518
Previous IDsprd-miR-7880-5p
Sequence

1 - 

ugaccuggaaugguguguaacagc

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-7880a-3p

Accession MIMAT0030519
Previous IDsprd-miR-7880-3p
Sequence

40 - 

uuugcgaccguauccaggcca

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).