Stem-loop sequence prd-mir-37

AccessionMI0025604 (change log)
DescriptionPanagrellus redivivus miR-37 stem-loop
Stem-loop
   --g     c   -    aa    u  -u   u 
5'    gauga ugu ugcc  ggug ug  guu u
      ||||| ||| ||||  |||| ||  |||  
3'    cuacu aca augg  ccac ac  caa u
   uaa     u   u    -g    u  uc   g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455389.1: 50760-50820 [+]
intergenic
Database links

Mature sequence prd-miR-37-5p

Accession MIMAT0030566
Sequence

1 - 

ggaugacuguugccaagguguug

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-37-3p

Accession MIMAT0030567
Sequence

39 - 

ucaccggguauacauucaucaau

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).