Stem-loop sequence prd-mir-235

AccessionMI0025622 (change log)
DescriptionPanagrellus redivivus miR-235 stem-loop
Gene family MIPF0000013; mir-25
Stem-loop
   -   aa      uu  g      u uuuu 
5'  agg  ggggcg  ug aauguu c    u
    |||  ||||||  || |||||| |     
3'  ucc  cccugc  ac uuauaa g    c
   g   gg      uc  g      u uugu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455447.1: 45208-45266 [-]
intergenic
Database links

Mature sequence prd-miR-235-5p

Accession MIMAT0030602
Sequence

1 - 

aggaaggggcguuuggaauguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-235-3p

Accession MIMAT0030603
Sequence

39 - 

uauugcacucgucccggccug

 - 59

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).