Stem-loop sequence prd-mir-7912

AccessionMI0025646 (change log)
DescriptionPanagrellus redivivus miR-7912 stem-loop
Stem-loop
   -c           uug     g  u  uua 
5'   auugcauuugg   uccuu gc ug   c
     |||||||||||   ||||| || ||    
3'   ugacguaaauu   aggaa ug ac   a
   ga           -ga     a  c  uaa 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455323.1: 202865-202924 [+]
intergenic
Clustered miRNAs
< 10kb from prd-mir-7912
prd-mir-7941KB455323.1: 201741-201800 [+]
prd-mir-7889KB455323.1: 202047-202107 [+]
prd-mir-7944KB455323.1: 202183-202242 [+]
prd-mir-7966aKB455323.1: 202407-202468 [+]
prd-mir-7966bKB455323.1: 202619-202680 [+]
prd-mir-7905KB455323.1: 202753-202809 [+]
prd-mir-7912KB455323.1: 202865-202924 [+]
Database links

Mature sequence prd-miR-7912-5p

Accession MIMAT0030650
Sequence

1 - 

cauugcauuugguuguccuuggcu

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-7912-3p

Accession MIMAT0030651
Sequence

39 - 

uaaaggaaguuaaaugcaguag

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).