Stem-loop sequence prd-mir-87

AccessionMI0025649 (change log)
DescriptionPanagrellus redivivus miR-87 stem-loop
Gene family MIPF0000152; mir-87
Stem-loop
   ---g     gg    g a    a   g  uag  u 
5'     gccug  acuu g cuca ccu cg   gc c
       |||||  |||| | |||| ||| ||   || g
3'     uggac  ugaa c gagu gga gc   ug a
   cgug     uu    a -    -   -  --u  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455127.1: 692615-692679 [+]
intergenic
Database links

Mature sequence prd-miR-87-5p

Accession MIMAT0030656
Sequence

1 - 

ggccugggacuuggacucaaccu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-87-3p

Accession MIMAT0030657
Sequence

44 - 

gugagcaaaguuucaggugugc

 - 65

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).