Stem-loop sequence prd-mir-7927e

AccessionMI0025672 (change log)
DescriptionPanagrellus redivivus miR-7927e stem-loop
Gene family MIPF0001660; mir-7927
Stem-loop
   -  -  g      uc         ugau 
5'  cg ga cguuuc  ugacugaug    a
    || || ||||||  |||||||||     
3'  gc cu gugaag  acugacuau    a
   u  u  a      uu         ugac 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455431.1: 49004-49059 [-]
intergenic
Database links

Mature sequence prd-miR-7927e-5p

Accession MIMAT0030702
Sequence

1 - 

cggagcguuucucugacugau

 - 21

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-7927e-3p

Accession MIMAT0030703
Sequence

35 - 

ucagucauugaagugaucucgu

 - 56

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).