Stem-loop sequence prd-mir-7928

AccessionMI0025673 (change log)
DescriptionPanagrellus redivivus miR-7928 stem-loop
Stem-loop
   --                      gucguauuu 
5'   uuuacggcuucaauucauuguu         a
     ||||||||||||||||||||||          
3'   gaaugccgagguuaaguaacaa         g
   uu                      aauuucacu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455390.1: 22277-22342 [-]
intergenic
Database links

Mature sequence prd-miR-7928-5p

Accession MIMAT0030704
Sequence

1 - 

uuuacggcuucaauucauuguu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-7928-3p

Accession MIMAT0030705
Sequence

45 - 

caaugaauuggagccguaaguu

 - 66

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).