Stem-loop sequence prd-mir-7938

AccessionMI0025688 (change log)
DescriptionPanagrellus redivivus miR-7938 stem-loop
Stem-loop
   --             g        uugc a 
5'   cgugucggcuguu aucacggu    c u
     ||||||||||||| ||||||||    | u
3'   gcauagccgacaa uagugcua    g u
   cu             g        cuaa u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455081.1: 77506-77566 [+]
intergenic
Database links

Mature sequence prd-miR-7938-5p

Accession MIMAT0030734
Sequence

1 - 

cgugucggcuguugaucacggu

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-7938-3p

Accession MIMAT0030735
Sequence

40 - 

cgugaugaacagccgauacguc

 - 61

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).