Stem-loop sequence prd-mir-7940a

AccessionMI0025690 (change log)
DescriptionPanagrellus redivivus miR-7940a stem-loop
Gene family MIPF0001719; mir-7940
Stem-loop
   -           -   u   uc   u  a 
5'  uggaagaugcg ucu cgu  auu gc u
    ||||||||||| ||| |||  ||| ||  
3'  acuuucuacgu agg gca  uaa ug u
   a           u   c   -c   u  u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455127.1: 278241-278297 [+]
intergenic
Clustered miRNAs
< 10kb from prd-mir-7940a
prd-mir-7951KB455127.1: 277291-277347 [-]
prd-mir-7940bKB455127.1: 277451-277507 [-]
prd-mir-7888KB455127.1: 277591-277648 [-]
prd-mir-7884KB455127.1: 278074-278133 [+]
prd-mir-7940aKB455127.1: 278241-278297 [+]
prd-mir-7881KB455127.1: 278420-278476 [+]
prd-mir-7940cKB455127.1: 278641-278698 [-]
Database links

Mature sequence prd-miR-7940a-5p

Accession MIMAT0030738
Sequence

1 - 

uggaagaugcgucuucguucauu

 - 23

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-7940a-3p

Accession MIMAT0030739
Sequence

36 - 

ucacgcggauugcaucuuucaa

 - 57

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).