Stem-loop sequence prd-mir-76

AccessionMI0025731 (change log)
DescriptionPanagrellus redivivus miR-76 stem-loop
Stem-loop
   --c        -u         c  u uuu 
5'    cagguuuu  gggcaacga ug g   c
      ||||||||  ||||||||| || |   u
3'    guccaaag  uuuguugcu ac c   a
   cgu        cu         u  u ucu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455028.1: 114562-114621 [-]
intergenic
Database links

Mature sequence prd-miR-76-5p

Accession MIMAT0030818
Sequence

1 - 

ccagguuuuugggcaacgacug

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-76-3p

Accession MIMAT0030819
Sequence

38 - 

uucguuguuuucgaaaccugugc

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).