Stem-loop sequence prd-mir-7965

AccessionMI0025738 (change log)
DescriptionPanagrellus redivivus miR-7965 stem-loop
Stem-loop
   --u   -      ca          -   ua 
5'    gcc guuuua  augcaaaaaa gag  g
      ||| ||||||  |||||||||| |||   
3'    cgg caaaau  uauguuuuuu cuu  u
   ucg   a      cg          a   gu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (Pred3; GCA_000341325.1) Overlapping transcripts
KB455519.1: 115245-115304 [+]
intergenic
Database links

Mature sequence prd-miR-7965-5p

Accession MIMAT0030830
Sequence

1 - 

ugccguuuuacaaugcaaaaaa

 - 22

Get sequence
Evidence experimental; Illumina [1]

Mature sequence prd-miR-7965-3p

Accession MIMAT0030831
Sequence

38 - 

uuuuguaugcuaaaacaggcgcu

 - 60

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23410827 "The draft genome and transcriptome of Panagrellus redivivus are shaped by the harsh demands of a free-living lifestyle" Srinivasan J, Dillman AR, Macchietto MG, Heikkinen L, Lakso M, Fracchia KM, Antoshechkin I, Mortazavi A, Wong G, Sternberg PW Genetics. 193:1279-1295(2013).