Stem-loop sequence stu-MIR7979

AccessionMI0025755 (change log)
DescriptionSolanum tuberosum miR7979 stem-loop
Stem-loop
   --    a a    c         -  a   -u   uc -ca   --uu    a 
5'   aggu c ugaa ucuaacgag gc uua  caa  c   agu    uaaa a
     |||| | |||| ||||||||| || |||  |||  |   |||    ||||  
3'   uuca g acuu agauuguuu cg aau  guu  g   uca    guuu u
   cg    - a    -         a  -   cc   uu aaa   uccu    c 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH138453.1: 184064-184161 [-]
intergenic
Database links

Mature sequence stu-miR7979

Accession MIMAT0030846
Sequence

1 - 

agguacaugaacucuaacgaggca

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).