Stem-loop sequence stu-MIR7987

AccessionMI0025769 (change log)
DescriptionSolanum tuberosum miR7987 stem-loop
Stem-loop
       u             -  u  ccga 
5' acac aguugaucuuauu ga ga    a
   |||| ||||||||||||| || ||     
3' ugug uuagcuagaauga cu cu    u
       u             u  u  uagu 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137812.1: 107558-107614 [+]
intergenic
Database links

Mature sequence stu-miR7987

Accession MIMAT0030860
Sequence

1 - 

acacuaguugaucuuauugaugac

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).