Stem-loop sequence stu-MIR8001a

AccessionMI0025800 (change log)
DescriptionSolanum tuberosum miR8001a stem-loop
Gene family MIPF0001852; MIR8001
Stem-loop
   --uc                     c        u 
5'     cuggggauuaguaugaaaauu gcaggaaa u
       ||||||||||||||||||||| |||||||| u
3'     gauccuuaaucauacuuuuaa cguccuuu a
   aaaa                     a        u 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137873.1: 1872569-1872639 [+]
intergenic
Database links

Mature sequence stu-miR8001a

Accession MIMAT0030891
Sequence

1 - 

uccuggggauuaguaugaaaauuc

 - 24

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).