Stem-loop sequence stu-MIR1886g

AccessionMI0025809 (change log)
DescriptionSolanum tuberosum miR1886g stem-loop
Gene family MIPF0001647; MIR1886
Literature search

1 open access papers mention stu-MIR1886g
(1 sentences)

Stem-loop
   --               uu    cau 
5'   gagaugagaucaaug  ugga   g
     |||||||||||||||  ||||    
3'   cucuacuuuaguuau  acuu   u
   ua               --    uag 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137938.1: 702521-702570 [+]
intergenic
Database links

Mature sequence stu-miR1886g-5p

Accession MIMAT0030900
Sequence

1 - 

gagaugagaucaauguuuggacau

 - 24

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR1886g-3p

Accession MIMAT0031194
Sequence

29 - 

uuucauauugauuucaucucau

 - 50

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).