Stem-loop sequence stu-MIR8034

AccessionMI0025853 (change log)
DescriptionSolanum tuberosum miR8034 stem-loop
Stem-loop
   --           c       a                      a  g           auu     g  c              u 
5'   uaugacaaaca ugcaaaa cuucauaaagagauaaaaacgu aa uauuccucuuu   aagug aa uuuuucuuacacuu a
     ||||||||||| ||||||| |||||||||||||||||||||| || |||||||||||   ||||| || ||||||||||||||  
3'   auacuguuugu acguuuu gaaguauuuuucuauuuuugca uu auaaggagaaa   uucac uu aaaaagaaugugaa u
   ac           a       c                      c  a           cau     a  a              a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137935.1: 1256821-1256992 [-]
intergenic
Database links

Mature sequence stu-miR8034

Accession MIMAT0030944
Sequence

1 - 

uaugacaaacacugcaaaaacu

 - 22

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).