Stem-loop sequence stu-MIR8041a

AccessionMI0025863 (change log)
DescriptionSolanum tuberosum miR8041a stem-loop
Gene family MIPF0001773; MIR8041
Stem-loop
   --  g         -uu       c   aa     u 
5'   gu cuuugcuau   ucauuga uuc  aauau g
     || |||||||||   ||||||| |||  |||||  
3'   cg gaaacgaua   aguaacu aag  uuaua u
   uc  a         ugu       u   ag     g 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (SolTub3.0; GCA_000226075.1) Overlapping transcripts
JH137872.1: 167537-167607 [-]
intergenic
Database links

Mature sequence stu-miR8041a-5p

Accession MIMAT0031221
Sequence

1 - 

gugcuuugcuauuuucauug

 - 20

Get sequence
Evidence experimental; Illumina [1]

Mature sequence stu-miR8041a-3p

Accession MIMAT0030954
Sequence

51 - 

augauguauagcaaagagccu

 - 71

Get sequence
Evidence experimental; Illumina [1]

References

1
PMID:23437348 "Identification and characterization of miRNA transcriptome in potato by high-throughput sequencing" Zhang R, Marshall D, Bryan GJ, Hornyik C PLoS One. 8:e57233(2013).